KEGG   Streptomyces sp. CNQ-509: AA958_32635Help
Entry
AA958_32635       gene      T03968                                 

Definition
(GenBank) pseudogene
Organism
strc  Streptomyces sp. CNQ-509
SSDB OrthologParalogGene clusterGFIT
Position
complement(7675613..7676211)
Genome map
NT seq 599 nt NT seq  +upstreamnt  +downstreamnt
ctggcggggcgggatgccaccgcggtgccggtcgtggacgatcggctggtcgggatgctg
gtcgaccgggtccgggccgagggctgcatctgaccggcgagggcgggctgctgccgcagc
tgaccaagcgggtcgtcgggtccgctctcgatggcgagatgaccgaccacctgggctacg
ggaagcacgaggcggccggccgggacggcggcaactcccgcaacggccgccgctcgaaga
cggtgaccgccggcgtcggcccggtcgagatcagcgtcccgcgggacgtcgagggcagcc
tagagccgcagatcgtgaagaagcggcagaggcggccgaccggggtggacgagatggtgc
tgtcgctgtccgccaagggcctcacgcacggcgagatctccgcccacctgtccgagggct
acggcgcgggcgtgtcgaagtcgacgatcaccacgatcaccacgatcaccacgatcacca
cgatcaccacgatcaccacgatcaccgacagcgtgatggacggcatggccgagtggcaga
accggccgctcgtctcgggacggtctaccccgtgctgttcgtggacgctatccacgtga

DBGET integrated database retrieval system