KEGG   Salmonella enterica subsp. enterica serovar Typhi Ty2: t3858Help
Entry
t3858             CDS       T00121                                 

Gene name
xylA
Definition
(GenBank) D-xylose isomerase
  KO
K01805  xylose isomerase [EC:5.3.1.5]
Organism
stt  Salmonella enterica subsp. enterica serovar Typhi Ty2
Pathway
stt00040  Pentose and glucuronate interconversions
stt00051  Fructose and mannose metabolism
stt01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:stt00001]
 Metabolism
  Carbohydrate metabolism
   00040 Pentose and glucuronate interconversions
    t3858 (xylA)
   00051 Fructose and mannose metabolism
    t3858 (xylA)
Enzymes [BR:stt01000]
 5. Isomerases
  5.3  Intramolecular oxidoreductases
   5.3.1  Interconverting aldoses and ketoses, and related compounds
    5.3.1.5  xylose isomerase
     t3858 (xylA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAO71338
UniProt: Q7C637
Position
3985803..3987125
Genome map
AA seq 440 aa AA seqDB search
MQAYFDQLDRVRYEGPQSTNPLAFRHYNPDELVLGKRMEDHLRFAACYWHTFCWNGADMF
GVGAFNRPWQQPGEALELAKRKADVAFEFFHKLNVPFYCFHDVDVSPKGASLKEYKNNFA
QMVDVLAAKQEQSGVKLLWGTANCFTNPRYGAGAATNPDPEVFSCAATQVVTAMNATHKL
GGENYVLWGGREGYETLLNTDLRQEREQIGRFMQMVVEHKHKMGFQGTLLIEPKPQEPTK
HQYDYDVATVYGFLKQFGLEKEIKVNIEANHATLAGHSFHHEIATAIALGIFGSVDANRG
DAQLGWDTDQFPISVEENALVMYEILKAGGFTTGGLNFDAKVRRQSTDKYDLFYGHIGAM
DTMALSLKIAARMVEDGELDKRVAKRYAGWNGELGQQILKGQLSLGELAQYAEQHHLAPV
HQSGHQELLENLVNRYLFDK
NT seq 1323 nt NT seq  +upstreamnt  +downstreamnt
atgcaggcttattttgaccaactcgatcgtgttcgctatgaaggccctcaatcgactaac
ccgctggcatttcgtcattacaatcccgacgagctggttttaggtaaacgtatggaagat
cacctgcgtttcgcggcctgttactggcataccttctgctggaacggcgcggatatgttt
ggcgtaggcgcgtttaatcgtccgtggcagcaaccgggcgaagcgctggagctggcgaaa
cgcaaagcggacgtggcgtttgaatttttccacaaactgaatgtgcctttttactgcttc
catgacgtggatgtgtcgccgaaaggcgcgtcgttgaaagaatataaaaacaacttcgcg
cagatggtggatgtgctggcggcgaaacaggagcagagcggcgtaaaactgctgtgggga
acggcgaactgctttaccaacccgcgctatggcgcaggcgccgccactaacccggacccg
gaagtctttagctgtgcagcgacgcaagtggttacggcaatgaacgccacgcataaactg
ggcggcgaaaattacgtactgtggggcggacgcgaaggttatgaaacgttgctgaatacc
gatctacgccaggaacgcgaacagattggccgctttatgcaaatggtggttgagcacaaa
cataaaatgggtttccagggcacgctgctgattgaaccgaaaccgcaggaaccgacaaaa
catcagtatgattatgacgttgcaacggtctatggcttcctcaaacagttcggcctggaa
aaagagatcaaagtgaacattgaggcgaaccacgccacgctggcgggccattcgttccac
catgaaatcgcaaccgctatcgcgctgggtatttttggctccgttgatgccaaccgcggc
gatgcgcaactgggctgggataccgatcagttcccgattagcgttgaagagaacgcgctg
gtgatgtacgaaatcctgaaagcgggcggattcacgacgggcggtctcaacttcgacgcc
aaagttcgtcgccagagcaccgataaatacgatctgttctacggtcatatcggcgcgatg
gatacgatggcgttgtcactgaaaatcgccgcgcgtatggtcgaagacggcgagttggat
aaacgcgtggcgaagcgctatgccggctggaatggcgagctggggcagcagattctgaaa
ggacaactctccttaggcgaactggcgcagtatgcggagcagcaccatctggcgccggta
catcaaagcggtcatcaggagctgttagaaaatctggttaaccgttatctgtttgataaa
taa

DBGET integrated database retrieval system