KEGG   Salmonella enterica subsp. enterica serovar Typhi CT18: STY0286
Entry
STY0286           gene      T00064                                 

Definition
(RefSeq) pseudogene
Organism
sty  Salmonella enterica subsp. enterica serovar Typhi CT18
SSDB
Other DBs
NCBI-GeneID: 1246776
GeneDB: STY0286
Position
complement(302488..303542)
NT seq 1055 nt   +upstreamnt  +downstreamnt
atggacatgtccctgactaaaccggtaagcgcggaacaaccctgcggccccgatccggag
tacgatccggaatacctgctgctgttcagccgcgccgccccccaggcggaggcgcaatat
ggtgattttgtcagtacgccggaagccgtgaactggccggaaattgagcgtgatgcgcgc
cgtctgctcacgcgcagtaaggatatccgggtgttgatcctgctgctgcgcagtcgcatc
cagcaggctggcgcacagggactggcggaaatgctcacacaactggcagaactgagcgta
atctggtctgatgcactccatccacagctgcttaccggcgaaggcgcatccgcagaatct
attgaagatgcggcgctggcgcgcagtaatgccctggcggcgcgctggatcacgaaggcg
tgatggcagacattcgcggtatcacgctgtcaaacagtgccgccctgcacctgcaggtac
gggacgtggagcgcgcgttatccgcccctcgcccggctgatgcgctggcccccgaatccg
tccgccagcaactggcagacctcgaagcccgtggggcattaccgctagcggcgtttcgcg
aagcgcaggaaagcgcagaacgcctgcaagtgtgggcgcgtgagacattaggcgatctgg
ctccagatttttcacgcctgcggcagttgttagcgctgctgcctgacgtggtacagacaa
ccacgccggaaatccctccgtcgccagcgccagcgccagctcccgcaggcacggttatgg
ataatgccattcctgcacgggcagaggatgtgccgcctgtcaacgcgccacccggtatat
ctatcccacacaatgctgaaccggggccaattcgcgatcgtaatgatgcgctggaacgcc
tgcggtgcattcgtcgctggtttgagagcagtgaacccagcagcccgaccatcccactat
tacgtcaggctgaaagactggtgggaaaacggttctcggaggtgatcaatgagatcccgg
tggagttgctggagaagtgggatgccctggagtga

DBGET integrated database retrieval system