KEGG   Streptomyces venezuelae: SVEN_6397Help
Entry
SVEN_6397         CDS       T02274                                 

Definition
(GenBank) WhiB-type transcriptional regulator
  KO
K18955  WhiB family transcriptional regulator, redox-sensing transcriptional regulator
Organism
sve  Streptomyces venezuelae
Brite
KEGG Orthology (KO) [BR:sve00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03000 Transcription factors [BR:sve03000]
    SVEN_6397
Transcription factors [BR:sve03000]
 Prokaryotic Type
  Other transcription factors
   Others
    SVEN_6397
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Whib
Motif
Other DBs
NCBI-ProteinID: CCA59683
UniProt: F2REZ8
Position
6982113..6982370
Genome map
AA seq 85 aa AA seqDB search
MQTYTTVLTAPEPDMSWQENALCAQAGPEFFFPAPGSSTREAKQLCGACEGRVACLEYAL
SNDERFGVWGGLSEKERVRLKRQGR
NT seq 258 nt NT seq  +upstreamnt  +downstreamnt
atgcagacctacacgaccgtactcaccgcaccggagcccgacatgtcctggcaggagaac
gctctgtgcgcccaggccgggccggagttcttcttcccggcgcccggttcgtccacccgc
gaggccaagcagctctgcggggcctgcgaggggcgggtggcatgcctggagtacgcgctc
agcaacgacgagcggttcggggtgtggggcggtctgtccgagaaggagcgggtgcggctc
aagcggcagggccgatga

DBGET integrated database retrieval system