KEGG   Streptomyces venezuelae: SVEN_t67Help
Entry
SVEN_t67          tRNA      T02274                                 

Definition
(GenBank) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
sve  Streptomyces venezuelae
Pathway
sve00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:sve00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    SVEN_t67
Non-coding RNAs [BR:sve03100]
 Transfer RNA
  tRNA
   SVEN_t67
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
7066697..7066770
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
cgggacgtggcgcagcttggtagcgcacttgactgggggtcaaggggtcgcaggttcaaa
tcctgtcgtcccga

DBGET integrated database retrieval system