KEGG   Shewanella woodyi: Swoo_3043Help
Entry
Swoo_3043         CDS       T00676                                 

Definition
(GenBank) malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
swd  Shewanella woodyi
Pathway
swd00620  Pyruvate metabolism
swd00630  Glyoxylate and dicarboxylate metabolism
swd01100  Metabolic pathways
swd01110  Biosynthesis of secondary metabolites
swd01120  Microbial metabolism in diverse environments
swd01200  Carbon metabolism
Module
swd_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:swd00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Swoo_3043
   00630 Glyoxylate and dicarboxylate metabolism
    Swoo_3043
Enzymes [BR:swd01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Swoo_3043
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACA87314
UniProt: B1KLL7
Position
complement(3728830..3729342)
Genome map
AA seq 170 aa AA seqDB search
MNTSTMRSTQNEQQMNDLISAEVVSMDAYAASKSEDTVAKAKGFLDTAFPLATGSHKDVS
SYVVYYQNLLMFFKDGTHSGLRDPRQFVALNGHKSEPSAILLQDKGTHVALTFDRCGTTG
SQDLADIDDIQLEGHKYWISILNIDEEGRTPKTEQDQLFTAKDGSDYLLK
NT seq 513 nt NT seq  +upstreamnt  +downstreamnt
atgaatacatcaactatgagaagtactcaaaacgaacaacagatgaatgaccttatcagt
gctgaagtcgtgtctatggatgcctatgctgcatcaaaaagtgaagacacagtagctaag
gctaaagggtttcttgatactgcatttccattggcaacgggttcacataaagatgtcagt
agctatgttgtttattaccaaaaccttttgatgttctttaaagatggtactcacagcggt
ttacgtgacccacgtcaatttgttgcccttaatggacataagagtgagccatcagcgatt
ttactgcaggataagggaactcatgtggcgctaacatttgaccgttgcggtacaacgggt
tcacaagatttagctgacatcgatgatatccaacttgaaggtcacaagtactggattagc
atactcaatattgatgaggagggcaggactccaaagacagaacaagatcagctgtttaca
gctaaagatggtagtgactacctgttaaaataa

DBGET integrated database retrieval system