KEGG   Synechococcus elongatus PCC6301: syc1044_d
Entry
syc1044_d         CDS       T00163                                 

Gene name
petN
Definition
(GenBank) cytochrome b6-f complex subunit VIII
  KO
K03689  cytochrome b6-f complex subunit 8
Organism
syc  Synechococcus elongatus PCC6301
Pathway
syc00195  Photosynthesis
syc01100  Metabolic pathways
Module
syc_M00162  Cytochrome b6f complex
Brite
KEGG Orthology (KO) [BR:syc00001]
 09100 Metabolism
  09102 Energy metabolism
   00195 Photosynthesis
    syc1044_d (petN)
 09180 Brite Hierarchies
  09181 Protein families: metabolism
   00194 Photosynthesis proteins [BR:syc00194]
    syc1044_d (petN)
Photosynthesis proteins [BR:syc00194]
 Photosystem and electron transport system
  Cytochrome b6/f complex [OT]
   syc1044_d (petN)
SSDB
Motif
Pfam: PetN
Other DBs
NCBI-ProteinID: BAD79234
CyanoBase: syc1044_d
CYORF: syc1044_d
UniProt: Q5N386
Position
1160327..1160431
AA seq 34 aa
MELLTFGWAALLAVFTFSLAMVVWGRNGDGSIGF
NT seq 105 nt   +upstreamnt  +downstreamnt
atggaactgttgaccttcggttgggccgctttgctggctgtcttcacgttctcgctggca
atggtggtctggggtcggaatggcgacggcagcattggcttctag

DBGET integrated database retrieval system