KEGG   Synechococcus elongatus PCC6301: syc1391_c
Entry
syc1391_c         CDS       T00163                                 

Gene name
petL
Definition
(GenBank) petL-like protein
  KO
K02642  cytochrome b6-f complex subunit 6
Organism
syc  Synechococcus elongatus PCC6301
Pathway
syc00195  Photosynthesis
syc01100  Metabolic pathways
Module
syc_M00162  Cytochrome b6f complex
Brite
KEGG Orthology (KO) [BR:syc00001]
 09100 Metabolism
  09102 Energy metabolism
   00195 Photosynthesis
    syc1391_c (petL)
 09180 Brite Hierarchies
  09181 Protein families: metabolism
   00194 Photosynthesis proteins [BR:syc00194]
    syc1391_c (petL)
Photosynthesis proteins [BR:syc00194]
 Photosystem and electron transport system
  Cytochrome b6/f complex [OT]
   syc1391_c (petL)
SSDB
Motif
Pfam: PetL
Other DBs
NCBI-ProteinID: BAD79581
CyanoBase: syc1391_c
CYORF: syc1391_c
UniProt: A0A0H3K2X3
Position
complement(1507594..1507686)
AA seq 30 aa
MGAVFFGLVLGGGIFTAIALLFGLRAVKLI
NT seq 93 nt   +upstreamnt  +downstreamnt
atgggcgcagtcttttttggcttggttcttggcggtggcatttttactgcgatcgcgctg
ctgttcggcctgcgcgctgtcaagctcatctaa

DBGET integrated database retrieval system