KEGG   Synechococcus elongatus PCC6301: sycRNA049_d
Entry
sycRNA049_d       tRNA      T00163                                 

Gene name
trnG-GCC
Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
syc  Synechococcus elongatus PCC6301
Pathway
syc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:syc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    sycRNA049_d (trnG-GCC)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:syc03100]
    sycRNA049_d (trnG-GCC)
Non-coding RNAs [BR:syc03100]
 Transfer RNA
  sycRNA049_d (trnG-GCC)
SSDB
Other DBs
CyanoBase: sycRNA049_d
CYORF: sycRNA049_d
Position
2007303..2007374
NT seq 72 nt   +upstreamnt  +downstreamnt
gcgggtatagctcagtggtagagcgtcaccttgccaaggtgaatgtcgcgcgttcgaatc
gcgttacccgct

DBGET integrated database retrieval system