KEGG   Synechococcus elongatus PCC6301: sycRNA050_d
Entry
sycRNA050_d       tRNA      T00163                                 

Gene name
trnS-GCU
Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
syc  Synechococcus elongatus PCC6301
Pathway
syc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:syc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    sycRNA050_d (trnS-GCU)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:syc03100]
    sycRNA050_d (trnS-GCU)
Non-coding RNAs [BR:syc03100]
 Transfer RNA
  sycRNA050_d (trnS-GCU)
SSDB
Other DBs
CyanoBase: sycRNA050_d
CYORF: sycRNA050_d
Position
2035741..2035829
NT seq 89 nt   +upstreamnt  +downstreamnt
ggagagatggctgagtggtcgaaagcagcacattgctaatgtgccgagtcgtgtacgcgg
ctccgagggttcgaatccctctctctccg

DBGET integrated database retrieval system