KEGG   Tolumonas auensis: Tola_2456
Entry
Tola_2456         gene      T00904                                 

Definition
(GenBank) pseudogene
Organism
tau  Tolumonas auensis
SSDB
Position
complement(2679774..2680055)
NT seq 282 nt   +upstreamnt  +downstreamnt
cctgcttggatgtcattcctgagccatgtgtatggcataacaagagccatggcggtggat
cctggctgggtcacaatggaactaagcgagacttacctggactcgcagccctatccgagc
gctgctcgagaagccctcaatcatctgcacccgcttggccgagtcggtcagtcggaagac
gtcggtgaccttgccgtttaccgcgcaagtgatcaatcaaggttcttgacgggacagatc
accgcgctggacagggggaggacggcaaagcgtccgctgccc

DBGET integrated database retrieval system