KEGG   Tolumonas auensis: Tola_R0080
Entry
Tola_R0080        tRNA      T00904                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
tau  Tolumonas auensis
Pathway
tau00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tau00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Tola_R0080
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:tau03100]
    Tola_R0080
Non-coding RNAs [BR:tau03100]
 Transfer RNA
  Tola_R0080
SSDB
Position
complement(2719076..2719151)
NT seq 76 nt   +upstreamnt  +downstreamnt
gcgggaatagctcagttggtagagcataaccttgccaaggttagggtcgcgagttcgagt
ctcgtttcccgctcca

DBGET integrated database retrieval system