KEGG   Thermodesulfatator indicus: Thein_0046Help
Entry
Thein_0046        CDS       T01546                                 

Definition
(GenBank) serine protease inhibitor
Organism
tid  Thermodesulfatator indicus
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEH43931
UniProt: F8A8C7
Position
complement(51009..51599)
Genome map
AA seq 196 aa AA seqDB search
MGDEIKSALEIALEKAAKIGKASKEELRKEKLEKEGRRLAARFLQEKDFNLLKAIAAISS
EDKPVVLRAAVDTLVRNIVFPRDELALSDIEKALKGLEVIFIDFPQVKELTAEIKKLLTL
YLQQQKQLFEQFKIQFKSQMGEIEEALKQQYGQSVKIEPEMLPQFQEEWGKVKGQLEAQY
KRQLDYFKDLFYKMLP
NT seq 591 nt NT seq  +upstreamnt  +downstreamnt
atgggagacgaaataaaaagcgctctagaaatagctcttgagaaggcagccaaaatcggc
aaggcttcaaaggaagaactgcgtaaagaaaaacttgaaaaagaaggccgaaggcttgcg
gcccgttttcttcaagaaaaagactttaaccttttgaaggccatagcggctatttcttct
gaagataagcccgttgttttgcgagctgcggttgataccctggtacgtaacatagtattt
cctcgagacgaactagccttaagtgacatagaaaaagccttaaaaggtcttgaagttatt
tttatagactttccccaggtaaaagaacttacagcggagataaaaaagctactcaccctt
tatctacaacagcaaaaacaactgtttgagcaatttaaaatacagtttaagagtcaaatg
ggagagattgaagaggcccttaaacagcaatatggccagtccgtaaaaatagaaccagag
atgcttcctcagtttcaggaagaatggggtaaggttaaagggcaacttgaggcccaatac
aagcgtcagcttgactattttaaagaccttttttacaagatgcttccatga

DBGET integrated database retrieval system