KEGG   Thermoanaerobacter italicus: Thit_R0060Help
Entry
Thit_R0060        tRNA      T01178                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
tit  Thermoanaerobacter italicus
Pathway
tit00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tit00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Thit_R0060
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:tit03100]
    Thit_R0060
Non-coding RNAs [BR:tit03100]
 Transfer RNA
  tRNA
   Thit_R0060
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1987018..1987093)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gggcctttagctcagctggcagagcggtcggctcataaccgattggtccggggttcaaat
ccctgaaggcccacca

DBGET integrated database retrieval system