KEGG   Thermoanaerobacter italicus: Thit_R0063Help
Entry
Thit_R0063        rRNA      T01178                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
tit  Thermoanaerobacter italicus
Pathway
tit03010  Ribosome
Brite
KEGG Orthology (KO) [BR:tit00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    Thit_R0063
Ribosome [BR:tit03011]
 Ribosomal RNAs
  Prokaryotes
   Thit_R0063
Non-coding RNAs [BR:tit03100]
 Ribosomal RNA
  Large subunit rRNA
   Thit_R0063
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1987266..1987374)
Genome map
NT seq 109 nt NT seq  +upstreamnt  +downstreamnt
cggtggcgatagcggaggggaaacacccgttcccattccgaacacggaagttaagccctc
cagcgccgatggtactgctttcgcgggagagtaggtcgctgccggaatt

DBGET integrated database retrieval system