KEGG   Tsukamurella paurometabola: Tpau_3809Help
Entry
Tpau_3809         gene      T01228                                 

Definition
(GenBank) pseudogene
Organism
tpr  Tsukamurella paurometabola
SSDB OrthologParalogGene clusterGFIT
Position
3930791..3932317
Genome map
NT seq 1527 nt NT seq  +upstreamnt  +downstreamnt
gtgagcatcgccgacctgctgctggcccgcgcagacgacccccgtgtcggcctgcgagca
ggcgagctctcctggacctgggccgagcacgtcgcggattcggcccgccgggcggccgcg
ctcgacgatctcctgcccgacggtgcgcctgcgcacttcggggttctcgccgacaacgtg
ccggagttctcattgcttctgggcgcggccgccctatccgggtcggtcctggtgggcctc
aatcccacccgtcgcggtacggctctcgcccgcgatatcgccctcgccgactgccaggtg
gtcttcacccaggggcggcatgccgcgctcctcgatggactcgacctcggcgtcccggtg
atcgacctcgacggcaccgcctggtccgacctcgtggaccgcgacgcggccccgccaccg
tcgtcctacggcccggaccggctgctggctctggtgttcacctcggggacgagcggggat
ccgaaggccgtgcaggccacgcacggcaagttcgagggcgcgggcaccatgctggcggac
cgcttcggcctcacaggcgacgatgtcgcctacgtctcgatgccgttgttccactccaac
gcgcttctcgccgggtggtcggtggcactcgcggcgggcgccaccatcgccctcgcggaa
cgtttctcggcgtcccggttcctcgacgacgtccgtcgatacggcgcgacctacgccaat
tacgtgggcactccgctgtcgtacattctggccacgcccgagctgcccgacgatgccgac
aatccgttgcgggtgctctacggcaacgaagggcgtgcggacgatatcgccgcgttcgcc
gcccgattcggctgccacgtgcaggacggctacggatcctcggagaacggggtcgcgatc
gcccgcaccccgaacacaccacgcaccgcgttggggccgctgccgccgggtatcgcggtg
tggcgggtgggcaccacggacgagtgcccgcgtgcgcggctcgccgccgacggtgcggta
ctcaatcccgatgaggcgatcggcgagctggtgaacacgtccggccggggcggattctcc
ggttattacaaggatcccgaggccgaggccgcccgctcggcgggcggcgtctaccgcacg
ggcgacctcgcctacgtcgacgaggacgactacgtctacttcgcgggccgcaccggtgac
tggatgcgagtgggcggggagaacctgggcgccgggcccatcgagcgggcgctggtgcgg
catccgctgatcgcggaagcggcggtgtacgggctaccggaccgggtgggagatcaggtc
gccgcggccgtggtcctcgcaccgggtgccgcactgaccgtagccgagatcgcggagttc
gtccgcgattaaacagatctgggtccgcgacaacgtccccggcggctacgcatcgtcgac
gagctgccgcgcaccccgtcgttcaaggtgctcaaacgggcactgcaggcggacgggatc
gcggcgacggtgccgttacccgggtag

DBGET integrated database retrieval system