KEGG   Tsukamurella paurometabola: Tpau_3892Help
Entry
Tpau_3892         gene      T01228                                 

Definition
(GenBank) pseudogene
Organism
tpr  Tsukamurella paurometabola
SSDB OrthologParalogGene clusterGFIT
Position
4012057..4012566
Genome map
NT seq 510 nt NT seq  +upstreamnt  +downstreamnt
gtggctaggccctgcctacgatgcggcaccccgagcaccacgacacggtgctcggggtgt
tctgcatccacgaccaagaagccgcgctccgtcgcacacgccggatccgatagccgatgg
cggcggatctccctcaaagcccgagaacagcagccctggtgcctcgactgcggcacaacc
agcgacctcacggccgaccacatcctgcccgtgtccgactacccggaactcgcgcacgag
atcgagaacgtcaccgtccgatgccgctcatgcaacagccgacgccgcgacacgtacacg
ccgaccgaagcccaggacgtcctcaaacgccttgagagcgcacacgaaagaacacgtaag
gcgaagtaccgcagcatgattctagtcgctcagaaggccgttcagacggtcggaaccagg
ggggaggccccgcctagcgggtctcagcaccccgtaggcaaggcgcggggcccgttactc
tcgacagtcattgtcgataaggcgtcatga

DBGET integrated database retrieval system