KEGG   Tsukamurella paurometabola: Tpau_3956Help
Entry
Tpau_3956         gene      T01228                                 

Definition
(GenBank) pseudogene
Organism
tpr  Tsukamurella paurometabola
SSDB OrthologParalogGene clusterGFIT
Position
complement(4076571..4079300)
Genome map
NT seq 2730 nt NT seq  +upstreamnt  +downstreamnt
gtgacggcgaacgaagtggactggatcctgagcgctagcgctgctgagcgtggagatctg
attctgcaagcgcgcgaggatcagtggtttgagcggaagagtgcgcgcacggagccgaag
acgttggccagggcgatggtggcatttgccaacgcggaaggcggaacgatagctgtcggg
gtgcacagcggcatcgtggagggcatggagcgacatcgcgggaggataaacgacctgcgt
caagcttcgatcgatcacacttctcctccggttcggtgcagttttcatgaggtggagtgc
gtcaatagcgaaggaatgcgggactccctgctcatagtgcgagttgatccgggagagcgt
gtgcacgaagtgaacggaggggattgtttgcttcgagttggggatgaatcgaggcgtctg
aacttcacacagcgtcaagaattggaatttgacaaggggcaggcgcagttcgacggtttc
agaattgctgagtactctgttgacgatctgagtacggatctgctggaacattatcggcag
gtgaccggtgcgacatctgcgcagtcaatactcaaggcgaggagtcttctgacgcgagac
ggttctcttacgaacgcgggctacctactgtttgcagatcatcctcagcaggcgttgcca
gagtcgtacgtccgtgtcttgaagtttctttcgaccgagagaggaagtggagcgcgactg
agcctagatgaggatgaggatcataagattgagggtccgttgccgtttgtgatcgaacaa
gctgcgaaattcgttgaacgcctggcgccgaagcgtcgagcgcttgacgatgagggaaaa
ttcgtcggtcaccatttggtgcctcgtgaggcgtggctcgaaggcttggtcaacgctgtt
attcatcgatcgtacagccttgctggcgatcatattcgagttgagatctatccagatcga
attgagattgagagtccgggtagattcccgggtctggtcgacccgtcgaaaccgctagac
ataagcaggttcgcccggaacccccgcattgcgcgagtgtgtgccgatctgagaatcggt
caagagctcggcgagggtatcaagcggatgggcctgctgcacgggtaggtgacaagttgg
tcaggccgcgtgtggcgcggccgggttcatggtggactcgaatgcgatgggtgtcaatcg
tccaaggcggcgttgtcggcgccggcggtggtaggtccgttcgatccaggtgatgatcgc
ggtccgcagttcctgccgggtggcccagcagtggcggtcgaggacgttgttctgcagcag
gctgaagaacgactccatcgcggcattgtcgccgcaggaggcgactcggcccattgatcc
gcgtagtccgtgatattccaaggcacgtcggaattttcggctccggaattgcgatcctct
gtcactatgaactatgcatccggtgacatcaccgcgcatcgcgacagcgttgttgagggc
gttgacggcgagccgggccttcatcctcgagtcgacggagtagccgacgatccgcccgga
gtaggcatctttgatcgcacacagatacagcttcccttcccgagccctgtgttcagtgat
atctgtgagccacaaccgattcggtgcatctgcggtgaaccggtgacgagtcctgccgtg
ctcgtcggtgacggtgcatagatcgtcgtggaccgcgggcccgggtttgccgcccttgct
cgagcgtttctttccgaagacgctccaccaccggttgtcgcggcagatccgccacgcagt
gcggtccgccataggctcaccggcagcgcgggcctcgtctgcgagtaaccggtgaccgaa
ctccggatcatcaacgctggcgtcgaacagggcgttcgcgcgatacgcctcgaccagctc
cgtcgcggggaccggggcggcgagccaacggtagtaaggctgacgggagagcttcaaaac
ccggcacgacaccgtgacgggaacaccgtcgtcggcgagctctttcacgagcgggtacat
cattttcccggcaggttcgcctgcgacagatacgcagccgcacgacgcaggacctcattc
tcctgctcaaggagccgaatccgcttacgcatttgcctctcggtcgccgactgcgccgca
ctgctcccggacttggagccggcctcgacatcggcggtcttcacccagttcatcaggcac
gactcgctaatgccgaagtcggcagcgatctgcttgagacggactcccggctcacgatta
cgcgcgacacggaccacatcgtcgcggaactccttcggatacggcttaggcacagtgcac
atccttccagcggcacccctcggcaccacagatcagatgtcacctacccgtgcagcaggc
ccgatgttcgaagagatgcgccgtgtcggtctgacagatcctgtatacgtgcagggtact
ggaagtgtaaggctccgcctggcggcgatcgctcggttggatccgcgcgtcgcagcatgc
ctgccgaagggagcccagaggatgttggatgtccttcaagcagcaggagtaccaatgggg
accggagagatcgcctcagctgtgggaatgagtcgtcctgcaaccatttctcgcttgcaa
gcgctccgggacgaggagctattggtttggtcgggaaagtctcccaacgacccaagggct
gtctgggctcttccatcaatgaaggtgtag

DBGET integrated database retrieval system