KEGG   Tsukamurella paurometabola: Tpau_R0050Help
Entry
Tpau_R0050        tRNA      T01228                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
tpr  Tsukamurella paurometabola
Pathway
tpr00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tpr00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Tpau_R0050
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:tpr03100]
    Tpau_R0050
Non-coding RNAs [BR:tpr03100]
 Transfer RNA
  tRNA
   Tpau_R0050
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
3988586..3988661
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gccgccttagctcagtcggtagagcgcttcactcgtaatgaaaaggtcgggggttcgatt
cccccaggcggctcca

DBGET integrated database retrieval system