KEGG   Turneriella parva: Turpa_2040Help
Entry
Turpa_2040        CDS       T02157                                 

Definition
(GenBank) phosphatidate cytidylyltransferase
Organism
tpx  Turneriella parva
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFM12686
UniProt: I4B5X9
Position
complement(2079504..2080292)
Genome map
AA seq 262 aa AA seqDB search
MPAEQKKLFSKDNQAGDKFNYARKLFHLIGLVIPVGYFFTWLDPVSPWQFKETTRSLIFW
ITGVITIFFLVIEFLRFRFKLWQDLFVKVAGPMLKGKELNKMHGSVPYILALCLVVGFFP
RDIAILSILFLTFGDPAAALVGGKYGTIRFYNGKSLQGTLGGIGGAFFSGLVFLLLLSAT
GVASDFVLWDTHGVRLENWLTLCIGAISALLIEFVSHEGLLDDNLTIPVGASLIMIGAHA
LFAGQNLAAYFNPIQDLLRTIH
NT seq 789 nt NT seq  +upstreamnt  +downstreamnt
atgcccgccgaacaaaagaaactctttagcaaagataaccaggccggtgacaagttcaac
tatgcccgcaagctttttcacctgattggtctcgtgattcccgtcggctatttcttcacc
tggctcgaccccgtcagcccatggcagttcaaagagacgacgcgctccctcatcttttgg
atcaccggcgtcatcaccatattttttctggtcattgagttcttgcgctttcgttttaaa
ctatggcaagacctgtttgtaaaggttgccggccccatgctcaagggtaaagagctcaac
aagatgcacggcagcgtgccttatattctcgcgctttgtcttgttgtgggtttttttccg
cgcgatatcgcaattctctccattctgtttctgacgttcggtgacccggcggctgcgctc
gtcggaggcaaatatggtacgatacgcttctacaacggcaagagccttcagggcacactc
ggcggcattggcggtgcattcttctcaggtctggtttttctgttgctgctttcagcgacc
ggcgtagcgtcagattttgttctgtgggatactcacggcgttcggcttgaaaactggctg
acgctgtgcatcggggcaatctctgctctgctcattgaatttgtgagccacgaaggtttg
ctcgatgacaacctaacgattccggtaggcgcatctctcatcatgattggcgcgcatgcc
cttttcgccggccaaaaccttgctgcatactttaacccgattcaagacctgctgcgtact
attcactag

DBGET integrated database retrieval system