KEGG   Terriglobus saanensis: AciPR4_R0048Help
Entry
AciPR4_R0048      tRNA      T01408                                 

Definition
(GenBank) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
tsa  Terriglobus saanensis
Pathway
tsa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tsa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    AciPR4_R0048
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:tsa03100]
    AciPR4_R0048
Non-coding RNAs [BR:tsa03100]
 Transfer RNA
  tRNA
   AciPR4_R0048
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
4240891..4240967
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
cgggacgtggctcagcctggtagagcgcacccttggggtgggtgaggtcgctagttcgaa
tctagtcgtcccgacca

DBGET integrated database retrieval system