KEGG   Treponema succinifaciens: Tresu_R0062Help
Entry
Tresu_R0062       tRNA      T01461                                 

Definition
(GenBank) tRNA-Trp
  KO
K14235  tRNA Trp
Organism
tsu  Treponema succinifaciens
Pathway
tsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Tresu_R0062
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:tsu03100]
    Tresu_R0062
Non-coding RNAs [BR:tsu03100]
 Transfer RNA
  tRNA
   Tresu_R0062
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2628701..2628773)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
aggtcagtagctcagttggtagagtcccggtctccaaaaccggttgtcgcgggttcgagt
cctgcctggcctg

DBGET integrated database retrieval system