KEGG   Treponema succinifaciens: Tresu_R0064Help
Entry
Tresu_R0064       tRNA      T01461                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
tsu  Treponema succinifaciens
Pathway
tsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tsu00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Tresu_R0064
Non-coding RNAs [BR:tsu03100]
 Transfer RNA
  tRNA
   Tresu_R0064
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2725007..2725080)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
gggctcttagctcagctggtacgagcgtctggtttacacccagaatgtcgggggttcgat
cccctcagagccca

DBGET integrated database retrieval system