KEGG   Variovorax paradoxus S110: Vapar_2696Help
Entry
Vapar_2696        gene      T00916                                 

Definition
(GenBank) pseudogene
Organism
vap  Variovorax paradoxus S110
SSDB OrthologParalogGene clusterGFIT
Position
1:complement(2839173..2840336)
Genome map
NT seq 1164 nt NT seq  +upstreamnt  +downstreamnt
atgaccgtctacctgcgccccggatccggggtctatcaattcgagttcgtagctcacggc
gagcgacatcgcggctccaccggcgaaaccgataaagccaaggcccgtgcctttgagatg
aaggagcgagcgaaggtccagcaggcccgcacagccaaagagcaaggtatcaaccacatg
accatgtgggaggtcgctcagtcttggctgaccgcatcccgtgacactcacaaggactat
cgcaataacgaaagccgggtgcggaagctgtttggaacagagctacagcagcgaggccgt
gagtgggtcgagatgcccaatgcccgctacggaatccctcgggacctgaagacccacgag
gttacccaagccatgctttccattctgaagggcaagcgcctggaagaagggtgcaagccg
ggcacgatcaatcgcgaaatgtcgctgctgcaatccctcctcggattcgcggagtcaatc
ggcgcccccctgccctccccgcccatcaagtggagcgcacggaacaatcgcgctgcctcg
ctgaagctaccggagacgaagggccgcatgcgctggctgacggtcgaggaggagcgcaag
ctcttggatggcctgatgctggaggccgagcggcggccgggagacatggcagcccaggac
tcatggcacctatgccagttcctcttggatacaggggcgcgatacaaggagattgccacg
ctgacgtgggacgtggtggacctggagcgcgggacgatcaatctgtatcggagcaaggtg
gacaacgaatcaacgttgcgcctgccctcccgctcatgggcaatgctcagggaccgtcac
aagatgatgaaggaccttggcttctccgtgattttcccgaagctgcggggccgcgcttgg
gacggcgaggacgtaagccgaggccacgcgacagccagtatccagcgccatctggacgcc
cttggcggggatcgcgctacacctcatgcgctgcgccacacgttcgcgtcccggatgcta
caggcaggggtgagtctggcgaaggtgtccaagctccttggacatgcgtcgattgcaatg
accgcgcgttacgcgcaccttgcggatggtgcactacacgaggaggctttggaggtgatg
gagcgcctgcacggcaacccaccc

DBGET integrated database retrieval system