KEGG   Vibrio anguillarum NB10: qrr1
Entry
qrr1              ncRNA     T03657                                 

Gene name
qrr1
Definition
(GenBank) Regulatory sRNA gene, qrr1
  KO
K15851  quorum regulatory RNA Qrr
Organism
vau  Vibrio anguillarum NB10
Pathway
vau02020  Two-component system
vau02024  Quorum sensing
vau05111  Biofilm formation - Vibrio cholerae
Brite
KEGG Orthology (KO) [BR:vau00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    qrr1 (qrr1)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    qrr1 (qrr1)
   05111 Biofilm formation - Vibrio cholerae
    qrr1 (qrr1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vau03100]
    qrr1 (qrr1)
Non-coding RNAs [BR:vau03100]
 Other RNA
  Unclassified
   qrr1 (qrr1)
SSDB
Position
1:complement(1072249..1072343)
NT seq 95 nt   +upstreamnt  +downstreamnt
tgacccttaggggtcacctagccaactgacgttgttagtgaataaagtgttcacaaataa
cagccaatagacctttttctattggctattttttt

DBGET integrated database retrieval system