KEGG   Vibrio anguillarum NB10: qrr2
Entry
qrr2              ncRNA     T03657                                 

Gene name
qrr2
Definition
(GenBank) Bacterial regulatory sRNA gene, qrr2: Quorum regulatory RNA; a non-coding RNA that is thought to be involved in the regulation of quorum sensing (QS) in Vibrio species.
  KO
K15851  quorum regulatory RNA Qrr
Organism
vau  Vibrio anguillarum NB10
Pathway
vau02020  Two-component system
vau02024  Quorum sensing
vau05111  Biofilm formation - Vibrio cholerae
Brite
KEGG Orthology (KO) [BR:vau00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    qrr2 (qrr2)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    qrr2 (qrr2)
   05111 Biofilm formation - Vibrio cholerae
    qrr2 (qrr2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vau03100]
    qrr2 (qrr2)
Non-coding RNAs [BR:vau03100]
 Other RNA
  Unclassified
   qrr2 (qrr2)
SSDB
Position
2:892099..892209
NT seq 111 nt   +upstreamnt  +downstreamnt
cgacccttcttaagccgagggtcacctagccaactgacgttgttagtgaatactctttgt
tcacaatttacataggccaatcgcgaatattgcggttggcttttttgtttt

DBGET integrated database retrieval system