KEGG   Vibrio cholerae O1 biovar El Tor N16961: VCA0745Help
Entry
VCA0745           gene      T00034                                 

Definition
(RefSeq) pseudogene
Organism
vch  Vibrio cholerae O1 biovar El Tor N16961
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2611909
Position
II:complement(689741..690596)
Genome map
NT seq 856 nt NT seq  +upstreamnt  +downstreamnt
atgaaccaaacaaagcaacatactctgctcgggcagtgtatcgccgagtttatcggtaca
ggattactgattttcttcggcgtcggctgcgtggccgcactcgttttagcaggtgctcaa
ttcggacaatgggaaatcagcattgtctggggttttggcgtatcgattgccatttattgt
acggctggggtttctggcgcgcacattaaccctgccgtcactatcgctctggccgctttc
cacggttttgataaagcgaaagtgctaccttacatcgtttcacaagtggctggtgcgttt
tgtgcggcggcactggtctactagcttgtacagcaatctttttaccgattacgaaatcgc
ccacaattttgtacgtagcagccaagaagccttagcgacagcggggatcttctcaactta
tccgcatgcttctctctcttttatgggagccatggccgttgagttcaccattacagcggt
actgatgttcgcgattttggcgttgggtgatgaaaacaatggcgcgcatcgcaatgcgat
gaaccccttgctaatcggtattttgattgcggtgattggtggctcattaggcccattgac
gggctttgccatgaaccctgcgcgtgatttcggtcctaaactgtttgcctacttcgcggg
atgggattatgccctaactggcgcaaaagagatcccttacttcatcgtaccgattgtggc
tccgattctgggcgcatgttttggcgcgtgggcatatccaaagtttatcgcggcttatct
gccaaaaacggggacgggttgcactattccgaaccaatgtgacacggcagaagagagtga
agaagcgcgcgcatag

DBGET integrated database retrieval system