KEGG   Vibrio cholerae O1 MJ-1236: VCD_002639Help
Entry
VCD_002639        CDS       T00903                                 

Definition
(GenBank) 1-aminocyclopropane-1-carboxylate deaminase
Organism
vcj  Vibrio cholerae O1 MJ-1236
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACQ60805
Position
1:complement(1787308..1788219)
Genome map
AA seq 303 aa AA seqDB search
MLITQSPITEHRFAGQTFYLKRDDKLHPHFSGNKARKLMALLEGDFPGITTLISYGSAQA
NSLYSFAALAKLRGWRLEFYVDHIPAWLKSYPIGNYRGALELGATIIETRSLGAKHPREF
IQQQRMPNTDCLVIEEGARSPFAEPGIKQLALEMLEWLRHQTQPDWVVALPSGTGTTALY
LHKYLQPHGVEVITCPCVGDESYLREQFLMLGETSHPTVLTSTTKHYFGHLYPEDYQIWQ
ALLAQTHIEFDLLYDPLMWRLLSAWRTENPDRNLLYLHQGGLLGNESMLPRYQRQFSEYT
LAT
NT seq 912 nt NT seq  +upstreamnt  +downstreamnt
atgctgatcactcaatcacctatcactgaacaccgttttgcagggcaaaccttttacctc
aaacgggatgacaaacttcatccacatttcagtggtaacaaagcccgcaaattgatggcg
ttgcttgaaggggattttcccggcatcaccaccttaatcagctacggttcggcacaagct
aactcgctctactcttttgcagcccttgctaaactgcgcggttggcgcttggagttttac
gttgaccatattcccgcgtggctgaaaagttatccaatcggtaactaccgtggtgcgctg
gaattgggagcgaccattattgaaacgcgctcactaggggctaagcatccacgagaattt
attcagcaacaacgcatgcccaataccgattgcttggtgattgaggaaggtgcgcgcagc
ccatttgcagagccgggaatcaaacaactagcgttagaaatgctcgaatggctccgccac
caaacccagccagattgggtggtcgccctgccttccggcaccggaaccacggcgctctac
ttacacaaatatttgcaaccacacggtgttgaagtcattacctgcccttgtgtgggtgac
gaatcctacttacgtgagcagtttttaatgctcggtgaaacctctcacccgacggttctg
acctctacgactaagcactatttcggtcatctttatccggaggattatcagatatggcaa
gcgttactggcacaaactcatattgaatttgatctgttatacgacccgctgatgtggcgt
ttattgtcagcttggcgtaccgagaacccagaccgaaacttgctttatctacaccaaggc
ggtttactgggaaatgaaagtatgttgccgcgttatcagcggcagtttagcgaatatacc
cttgctacttga

DBGET integrated database retrieval system