KEGG   Vibrio cholerae O1 MJ-1236: VCD_rna102Help
Entry
VCD_rna102        tRNA      T00903                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
vcj  Vibrio cholerae O1 MJ-1236
Pathway
vcj00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:vcj00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    VCD_rna102
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vcj03100]
    VCD_rna102
Non-coding RNAs [BR:vcj03100]
 Transfer RNA
  tRNA
   VCD_rna102
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1:complement(1771454..1771541)
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
ggtgagttgtccgagtggctgaaggagcacgcctggaaagtgtgtatacggcaacgtatc
gagagttcgaatctctcactcaccgcca

DBGET integrated database retrieval system