KEGG   Vibrio cholerae O49 1154-74: VAA049_2035Help
Entry
VAA049_2035       CDS       T03828                                 

Definition
(GenBank) putative malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
vcx  Vibrio cholerae O49 1154-74
Pathway
vcx00620  Pyruvate metabolism
vcx00630  Glyoxylate and dicarboxylate metabolism
vcx01100  Metabolic pathways
vcx01110  Biosynthesis of secondary metabolites
vcx01120  Microbial metabolism in diverse environments
vcx01200  Carbon metabolism
Module
vcx_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vcx00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00620 Pyruvate metabolism
    VAA049_2035
   00630 Glyoxylate and dicarboxylate metabolism
    VAA049_2035
Enzymes [BR:vcx01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VAA049_2035
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AKB02867
UniProt: A0A0E4CBK1
Position
2267585..2268163
Genome map
AA seq 192 aa AA seqDB search
MNMLTFDKTEIQHQNKPFIAEAVFAVETVAANQQREKQTKAKQLLDRLFPLENGTHQDVT
AYVIDYNHLLAYFQDGRHSGLKYPKQFVAFNGSKENPSHLLFRDGQGSHVEMTLGCQRGT
GCIELREIADIQLEMCTVLNHSNDHAQPSTTIRHWVSLIKGDEQGRPQARIEEKEYTARN
GDEYFLGDCFSH
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgctgacgtttgataaaacagaaatccaacaccaaaacaaaccctttatcgct
gaagctgtgttcgccgtagaaacggtcgccgccaatcaacagcgtgaaaaacaaaccaaa
gccaaacagttattggatcgcctgtttccgcttgaaaatggtactcaccaagatgtgacc
gcatacgtgatagattacaaccatctgctcgcttactttcaagatggacgtcatagtggc
ttgaaatacccaaaacagtttgtggcgtttaatggcagtaaagaaaatccaagccatctt
ctgtttcgtgatgggcaaggtagtcatgttgaaatgacattaggttgccagcgcggcacg
ggttgcattgagttacgagaaatcgcagatattcaattagaaatgtgcacggtactcaat
cattccaatgaccacgcacaaccaagcaccactattcgccactgggtaagtttgattaaa
ggcgatgaacaaggtcgaccacaagctcgtattgaagagaaagagtatacagctcgaaat
ggtgacgaatatttcctcggagactgtttttcacattaa

DBGET integrated database retrieval system