KEGG   Vibrio cholerae O27 10432-62: VAB027_1167Help
Entry
VAB027_1167       CDS       T03829                                 

Definition
(GenBank) putative malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
vcz  Vibrio cholerae O27 10432-62
Pathway
vcz00620  Pyruvate metabolism
vcz00630  Glyoxylate and dicarboxylate metabolism
vcz01100  Metabolic pathways
vcz01110  Biosynthesis of secondary metabolites
vcz01120  Microbial metabolism in diverse environments
vcz01200  Carbon metabolism
Module
vcz_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vcz00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00620 Pyruvate metabolism
    VAB027_1167
   00630 Glyoxylate and dicarboxylate metabolism
    VAB027_1167
Enzymes [BR:vcz01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VAB027_1167
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AKB08533
Position
1286670..1287248
Genome map
AA seq 192 aa AA seqDB search
MNMLTFDKTEIQHQNKPFIAEAVFAVETVAANQLREKQTKAKQLLDRLFPLENGTHQDVT
AYVIDYNHLLAYFQDGRHSGLKYPKQFVAFNGSKENPSHLLFRDGQGSHVEMTLGCQRGT
GCIELREIADIQLETCTVLNHSNDHAHPSTTIRHWVSLIKGDEQGRPQARIEEKEYTARN
GDEYFLGDCFSH
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgctgacgtttgataaaacagaaatccaacaccaaaacaaaccctttatcgct
gaagctgtgttcgccgtagaaacggtcgccgccaatcaactgcgtgaaaaacaaaccaaa
gccaaacagttattggatcgcctgtttccgcttgaaaatggtactcaccaagatgtgacc
gcatacgtgatagattacaaccatctgctcgcttactttcaagatggacgtcatagtggc
ttgaaatacccaaaacagtttgtggcgtttaatggcagtaaagaaaatccaagccatctt
ctgtttcgtgatgggcaaggtagtcatgtcgaaatgacattaggttgccagcgcggtacg
ggttgcattgagttacgagaaatcgcagatattcaattagaaacgtgtacggtactcaat
cattccaatgaccacgcacatccaagtaccactattcgccactgggtaagtttgatcaaa
ggcgatgaacaaggtcgaccacaagctcgtattgaagagaaagagtatacagctcgaaat
ggtgacgaatatttcctcggagactgtttttcacattaa

DBGET integrated database retrieval system