KEGG   Aliivibrio fischeri ES114: VF_2597
Entry
VF_2597           misc_RNA  T00236                                 

Gene name
qrr1
Definition
(GenBank) Qrr1 quorum regulatory RNA
  KO
K15851  quorum regulatory RNA Qrr
Organism
vfi  Aliivibrio fischeri ES114
Pathway
vfi02020  Two-component system
vfi02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:vfi00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    VF_2597 (qrr1)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    VF_2597 (qrr1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vfi03100]
    VF_2597 (qrr1)
Non-coding RNAs [BR:vfi03100]
 Other RNA
  Unclassified
   VF_2597 (qrr1)
SSDB
Position
I:complement(1033236..1033341)
NT seq 106 nt   +upstreamnt  +downstreamnt
tgaccctttaagccaaagggtcacctagccaactgacgttgttagtgaaatttactttca
catgaacaataaagccaaccgggatattgcggttggcttctttttt

DBGET integrated database retrieval system