KEGG   Aliivibrio fischeri ES114: VF_B0057Help
Entry
VF_B0057          CDS       T00236                                 

Definition
(RefSeq) type IV secretion (pTiA6 VirB7)
Organism
vfi  Aliivibrio fischeri ES114
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 6175937
NCBI-ProteinID: YP_001816755
UniProt: B1WN91
Position
pES100:28724..28846
Genome map
AA seq 40 aa AA seqDB search
MNNITLLCLSLLLLSGCSSVSPHAQPSYQQAPIEVINDAQ
NT seq 123 nt NT seq  +upstreamnt  +downstreamnt
atgaacaacatcaccctattgtgtcttagccttttattattaagcggctgctctagcgtc
tcaccacacgctcaaccatcctatcaacaagctccgattgaggtgattaatgatgctcaa
taa

DBGET integrated database retrieval system