KEGG   Viruses: 1732997
Entry
1732997           CDS       T40000                                 

Gene name
IIV6gp236
Definition
(RefSeq) Invertebrate iridescent virus 6; 240R
Taxonomy
TAX:176652
  Lineage
Viruses; dsDNA viruses; Iridoviridae; Betairidovirinae; Iridovirus
Organism
vg  Viruses (Invertebrate iridescent virus 6)
SSDB
Other DBs
NCBI-GeneID: 1732997
NCBI-ProteinID: NP_149703
RS: NC_003038
UniProt: Q91FT2
Position
NC_003038:113666..113854
AA seq 62 aa
MTSRGHLRRAPCCYAFKSATSHQRTRTSLCLASPPAPHCLLLYSHRCLTYFTVDYELSFF
CL
NT seq 189 nt   +upstreamnt  +downstreamnt
atgacgtcacgcggccacctgcgccgcgctccgtgttgctacgcattcaagtccgccaca
agccatcagcgcacgcgcacgtcgctctgtctcgcgtcgccccccgcgcctcactgcttg
cttttatactcgcaccgctgcttaacctattttactgtggactatgaactttctttcttc
tgcttgtga

DBGET integrated database retrieval system