KEGG   Viruses: 2703441Help
Entry
2703441           CDS       T40000                                 

Gene name
US12, HHV1gp00p04
Definition
(RefSeq) Human alphaherpesvirus 1; TAP transporter inhibitor ICP47
  KO
K19446  ICP47 protein
Taxonomy
TAX:10298 [GN:T40073]
  Lineage
Viruses; dsDNA viruses; Herpesvirales; Herpesviridae; Alphaherpesvirinae; Simplexvirus
Taxonomy
Organism
vg  Viruses (Human alphaherpesvirus 1)
SSDB OrthologParalogGFIT
Motif
Pfam: Herpes_US12
Motif
Other DBs
NCBI-GeneID: 2703441
NCBI-ProteinID: YP_009137148
RS: NC_001806
UniProt: P03170 G8HBI7
Structure
PDB: 

Position
NC_001806:complement(145316..145582)
AA seq 88 aa AA seqDB search
MSWALEMADTFLDTMRVGPRTYADVRDEINKRGREDREAARTAVHDPERPLLRSPGLLPE
IAPNASLGVAHRRTGGTVTDSPRNPVTR
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atgtcgtgggccctggaaatggcggacaccttcctggacaccatgcgggttgggcccagg
acgtacgccgacgtacgcgatgagatcaataaaagggggcgtgaggaccgggaggcggcc
agaaccgccgtgcacgacccggagcgtcccctgctgcgctctcccgggctgctgcccgaa
atcgcccccaacgcatccttgggtgtggcacatcgaagaaccggcgggaccgtgaccgac
agtccccgtaatccggtaacccgttga

DBGET integrated database retrieval system