KEGG   Viruses: 3802042
Entry
3802042           CDS       T40000                                 

Gene name
PB1-F2, FLUAVs2gp2
Definition
(RefSeq) Influenza A virus (A/Puerto Rico/8/1934(H1N1)); PB1-F2 protein
  KO
K19397  Influenza A virus protein PB1-F2
Taxonomy
TAX:211044 [GN:T40035]
  Lineage
Viruses; -ssRNA viruses; Riboviria; Orthornavirae; Negarnaviricota; Polyploviricotina; Insthoviricetes; Articulavirales; Orthomyxoviridae; Alphainfluenzavirus; Influenza A virus; H1N1 subtype
Organism
vg  Viruses (Influenza A virus)
SSDB
Motif
Pfam: PB1-F2
Other DBs
NCBI-GeneID: 3802042
NCBI-ProteinID: YP_418248
RS: NC_002021
UniProt: P0C0U1
Position
NC_002021:119..382
AA seq 87 aa
MGQEQDTPWILSTGHISTQKRQDGQQTPKLEHRNSTRLMGHCQKTMNQVVMPKQIVYWKQ
WLSLRNPILVFLKTRVLKRWRLFSKHE
NT seq 264 nt   +upstreamnt  +downstreamnt
atgggacaggaacaggatacaccatggatactgtcaacaggacacatcagtactcagaaa
aggcaagatggacaacaaacaccgaaactggagcaccgcaactcaacccgattgatgggc
cactgccagaagacaatgaaccaagtggttatgcccaaacagattgtgtattggaagcaa
tggctttccttgaggaatcccatcctggtatttttgaaaactcgtgtattgaaacgatgg
aggttgttcagcaaacacgagtag

DBGET integrated database retrieval system