KEGG   Vibrio campbellii: VIBHAR_02960
Entry
VIBHAR_02960      misc_RNA  T00589                                 

Definition
(GenBank) Qrr RNA
  KO
K15851  quorum regulatory RNA Qrr
Organism
vha  Vibrio campbellii
Pathway
vha02020  Two-component system
vha02024  Quorum sensing
vha05111  Biofilm formation - Vibrio cholerae
Brite
KEGG Orthology (KO) [BR:vha00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    VIBHAR_02960
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    VIBHAR_02960
   05111 Biofilm formation - Vibrio cholerae
    VIBHAR_02960
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vha03100]
    VIBHAR_02960
Non-coding RNAs [BR:vha03100]
 Other RNA
  Unclassified
   VIBHAR_02960
SSDB
Position
I:2983624..2983718
NT seq 95 nt   +upstreamnt  +downstreamnt
ggacccctcgggtcacctatccaactgacgttgttagtgaacgacatgttcacagaacga
gccaatagatccgactgcctattggcttctttttt

DBGET integrated database retrieval system