KEGG   Vibrio nigripulchritudo: VIBNI_BmiscRNA_2
Entry
VIBNI_BmiscRNA_2  misc_RNA  T02871                                 

Definition
(GenBank) Qrr
  KO
K15851  quorum regulatory RNA Qrr
Organism
vni  Vibrio nigripulchritudo
Pathway
vni02020  Two-component system
vni02024  Quorum sensing
vni05111  Biofilm formation - Vibrio cholerae
Brite
KEGG Orthology (KO) [BR:vni00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    VIBNI_BmiscRNA_2
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    VIBNI_BmiscRNA_2
   05111 Biofilm formation - Vibrio cholerae
    VIBNI_BmiscRNA_2
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vni03100]
    VIBNI_BmiscRNA_2
Non-coding RNAs [BR:vni03100]
 Other RNA
  Unclassified
   VIBNI_BmiscRNA_2
SSDB
Position
2:52718..52826
NT seq 109 nt   +upstreamnt  +downstreamnt
tgacccttttaaagccgagggtcacctagccaactgacgttgttagtgaatattatttgt
tcacactatctatcagccaatcgcacttattgcggttggctcttttttt

DBGET integrated database retrieval system