KEGG   Vibrio owensii: A9237_17060Help
Entry
A9237_17060       CDS       T04844                                 

Definition
(GenBank) malate synthase
  KO
K01638  malate synthase [EC:2.3.3.9]
Organism
vow  Vibrio owensii
Pathway
vow00620  Pyruvate metabolism
vow00630  Glyoxylate and dicarboxylate metabolism
vow01100  Metabolic pathways
vow01110  Biosynthesis of secondary metabolites
vow01120  Microbial metabolism in diverse environments
vow01200  Carbon metabolism
Module
vow_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vow00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00620 Pyruvate metabolism
    A9237_17060
   00630 Glyoxylate and dicarboxylate metabolism
    A9237_17060
Enzymes [BR:vow01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     A9237_17060
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AQW59764
UniProt: A0A3G2PZP9
Position
2:102775..103353
Genome map
AA seq 192 aa AA seqDB search
MNMLNFDKKDIQQQERPFIAEAVFAVEAVSAEQQSEKQVKAKQLLDRMFPLENGSHQDVS
SYVIDYRHVMAYFKDGTHSGLKSPKHFVAYTGEKEDPKSILFKDESGSHAEVMFGCHKGT
GCVELMDIDDIQLETRTTFSPELTGNAPTAMRHWISLIKGDKKGKPMACSEDKEYTAKNG
DDYFLSYCYSID
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgctgaatttcgataaaaaagacatccaacaacaagaacgcccatttatcgct
gaagccgtatttgccgtcgaggcggtaagtgctgagcagcagagcgagaaacaagttaag
gcgaagcaactactagaccgtatgttcccactggagaacggttctcaccaagatgtatca
agctacgtgatcgactaccgccatgttatggcttacttcaaagacggtacccacagcggt
ctgaaaagcccaaagcattttgtagcgtacacaggtgagaaagaagaccctaaatcgatt
ctgtttaaagacgaatcaggtagccacgcagaagtgatgtttggttgtcacaaaggcaca
ggttgtgtggagttgatggacatcgacgatatccaattggagacacgcaccacctttagt
cctgaactaaccggcaatgcaccaactgcgatgcgccactggatcagcctaatcaaaggc
gataagaaaggtaaaccaatggcatgcagtgaagacaaagaatacaccgcgaagaacggc
gatgattacttcttaagctactgctacagcattgattaa

DBGET integrated database retrieval system