KEGG   Aliivibrio salmonicida: VSAL_I3165s
Entry
VSAL_I3165s       misc_RNA  T00782                                 

Gene name
qrr
Definition
(GenBank) small RNA Qrr
  KO
K15851  quorum regulatory RNA Qrr
Organism
vsa  Aliivibrio salmonicida
Pathway
vsa02020  Two-component system
vsa02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:vsa00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    VSAL_I3165s (qrr)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    VSAL_I3165s (qrr)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vsa03100]
    VSAL_I3165s (qrr)
Non-coding RNAs [BR:vsa03100]
 Other RNA
  Unclassified
   VSAL_I3165s (qrr)
SSDB
Position
1:complement(2009721..2009826)
NT seq 106 nt   +upstreamnt  +downstreamnt
tgaccctttaagccaaagggtcacctagccaactgacgttgttagtgaaatttactttca
catgaacaataaagccaaccggtatattacggttggcttctttttt

DBGET integrated database retrieval system