KEGG   Vibrio atlanticus: VS_m0981
Entry
VS_m0981          ncRNA     T00812                                 

Definition
(GenBank) Qrr
  KO
K15851  quorum regulatory RNA Qrr
Organism
vsp  Vibrio atlanticus
Pathway
vsp02020  Two-component system
vsp02024  Quorum sensing
vsp05111  Biofilm formation - Vibrio cholerae
Brite
KEGG Orthology (KO) [BR:vsp00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   02020 Two-component system
    VS_m0981
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    VS_m0981
   05111 Biofilm formation - Vibrio cholerae
    VS_m0981
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:vsp03100]
    VS_m0981
Non-coding RNAs [BR:vsp03100]
 Other RNA
  Unclassified
   VS_m0981
SSDB
Position
1:complement(1015027..1015119)
NT seq 93 nt   +upstreamnt  +downstreamnt
tgaccttcgggtcacctagccaactgacgttgttagtggacggagtgtccacaaacgtaa
gccagtagaacgtttcctactggctgttttttt

DBGET integrated database retrieval system