KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00494Help
Entry
VVMO6_00494       CDS       T01415                                 

Definition
(GenBank) 5-nucleotidase SurE
  KO
K03787  5'-nucleotidase [EC:3.1.3.5]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
vvm00230  Purine metabolism
vvm00240  Pyrimidine metabolism
vvm00760  Nicotinate and nicotinamide metabolism
vvm01100  Metabolic pathways
vvm01110  Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:vvm00001]
 09100 Metabolism
  09104 Nucleotide metabolism
   00230 Purine metabolism
    VVMO6_00494
   00240 Pyrimidine metabolism
    VVMO6_00494
  09108 Metabolism of cofactors and vitamins
   00760 Nicotinate and nicotinamide metabolism
    VVMO6_00494
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.3  Phosphoric-monoester hydrolases
    3.1.3.5  5'-nucleotidase
     VVMO6_00494
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV85516
Position
I:549329..550096
Genome map
AA seq 255 aa AA seqDB search
MEDKQAKPLRILLSNDDGVFAEGIRTLASELRTLAEVIIVAPDRNRSGASNSLTLEQPLR
VTCVEENMYSVQGTPTDCVHFALNELLKNDLPDLVLSGINHGANLGDDVLYSGTVAAAME
GHFLGVQSIAFSLVGKNHFKTAATIAKRIVEQHLAKPIPTNRLLNINIPDLPLEQLKEIR
VTRLGARHHAENMIKQLDPRGHEIYWLGPPGKEQDAGEGTDFHAIEQGYVSITPLQVDLT
AHESLRAMDTWLKEK
NT seq 768 nt NT seq  +upstreamnt  +downstreamnt
atggaagataagcaagctaaaccgctgcgcattttgctgagtaatgacgatggcgttttc
gcagaaggtattcgcacgttagctagtgagctaagaacattggcagaagtgatcatcgtt
gctccggatcgcaatcgctcaggagcgtcgaactcgttaacactggaacagccgctgcga
gtgacctgtgttgaagaaaatatgtattcagtgcaaggcacgccgacagattgtgtccat
tttgctttaaacgaactactgaaaaatgatctcccagacttagtgttaagtggcatcaat
catggcgccaatctgggggatgacgtgctttattcgggcacggtcgccgcagcgatggaa
gggcattttcttggcgtgcagtcgatcgctttttctttggttggtaaaaaccactttaaa
accgcagcaaccattgctaagcggatcgttgagcaacatttagcgaaacctattccgacc
aatcgtttattgaatatcaatattccggatctgccgctcgaacagctaaaagagatacga
gtgactcgtttaggcgctcgccatcatgcagagaatatgatcaagcagcttgatccccgt
ggtcatgaaatctattggttaggccctccgggtaaagagcaagatgcgggggagggaacc
gattttcatgcgattgaacaaggctatgtgtccattacaccactgcaagttgatttaact
gcccatgaatcgctccgagcgatggatacttggctaaaggaaaagtaa

DBGET integrated database retrieval system