KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01662Help
Entry
VVMO6_01662       CDS       T01415                                 

Definition
(GenBank) siroheme synthase / Precorrin-2 oxidase / Sirohydrochlorin ferrochelatase
  KO
K02304  precorrin-2 dehydrogenase / sirohydrochlorin ferrochelatase [EC:1.3.1.76 4.99.1.4]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
vvm00860  Porphyrin and chlorophyll metabolism
vvm01100  Metabolic pathways
vvm01110  Biosynthesis of secondary metabolites
vvm01120  Microbial metabolism in diverse environments
Module
vvm_M00846  Siroheme biosynthesis, glutamate => siroheme
Brite
KEGG Orthology (KO) [BR:vvm00001]
 09100 Metabolism
  09108 Metabolism of cofactors and vitamins
   00860 Porphyrin and chlorophyll metabolism
    VVMO6_01662
Enzymes [BR:vvm01000]
 1. Oxidoreductases
  1.3  Acting on the CH-CH group of donors
   1.3.1  With NAD+ or NADP+ as acceptor
    1.3.1.76  precorrin-2 dehydrogenase
     VVMO6_01662
 4. Lyases
  4.99  Other lyases
   4.99.1  Sole sub-subclass for lyases that do not belong in the other subclasses
    4.99.1.4  sirohydrochlorin ferrochelatase
     VVMO6_01662
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV86684
Position
I:complement(1769453..1770373)
Genome map
AA seq 306 aa AA seqDB search
MRYFPLFMDLENKPVLVVGGGEVASRKIEALLNVGAKVTIVSPTLVDELHRWVEENRCYW
VKNFYSSELMDGAYVQVWATTNNPSLNHQVYRDAKQRNLLVNVVDDKPYCDFITPSMISR
GRVQIAISSGGASPVLIRNLRESLEAVLPQNLSLLAEFAESKRVAVKERFPTVEERRMFW
ELFFDLPEVKSSQNHRELETLFAQAIKGEVQRTAQCTWIGCTEDVELLPIKALRYMQKAE
LVLAPEQIHPAFLEMVRRDAQRLSYETPAQLSEKIQQAKLEPIKICVLFAKNSQEFSFLQ
QGDLII
NT seq 921 nt NT seq  +upstreamnt  +downstreamnt
atgcgatattttcctcttttcatggatctagaaaacaaacccgtacttgttgtcggagga
ggggaagttgccagtcgtaaaattgaagcgctgttaaatgtcggggcgaaagtaacgatc
gtctcgccgacattggtggatgagcttcaccgttgggtggaggaaaaccgctgttactgg
gtgaaaaatttctattcatctgagttgatggatggggcttatgttcaagtctgggcgaca
accaacaatccgtctctcaaccatcaagtataccgtgacgctaaacagcgcaatctgttg
gtgaacgtcgtggatgataaaccgtattgtgacttcattacgccttcaatgatctcgcgt
gggcgagtgcaaattgccatatccagtggtggtgcttcccctgtgttgattcgtaatctc
agagaatcattagaagcggttttgccacaaaatcttagtttgctggcggagttcgccgag
tcaaaacgtgtagcggttaaagagcgattcccgacagtcgaagaacgtcgcatgttttgg
gagctgttttttgacttaccagaggtcaaatcgtcacaaaatcatagagagcttgaaacc
ttgtttgcacaggcaatcaaaggggaggttcaacgaactgcgcaatgcacatggattggt
tgcacagaagatgttgagctgttacctattaaagcccttcgttatatgcaaaaagcggag
cttgtgttggcaccagagcagattcatcctgcttttctagaaatggtgcgtcgagatgcc
caacgtttgagttatgaaactccggcacaactctcggaaaagattcaacaagcgaagctc
gagccgattaaaatctgcgtgttatttgctaaaaacagccaagaattcagctttcttcaa
caaggtgatctgattatctga

DBGET integrated database retrieval system