KEGG   Xenorhabdus bovienii SS-2004: XBJ1_1525Help
Entry
XBJ1_1525         CDS       T01186                                 

Definition
(GenBank) putative lipoprotein
Organism
xbo  Xenorhabdus bovienii SS-2004
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: CBJ80652
UniProt: D3V0A0
Position
complement(1488319..1488720)
Genome map
AA seq 133 aa AA seqDB search
MRKIKYYWLLGLAGLLVGCTTSKDALLPAGKQTVLAMWQGNKAGHATESARETLRRSLTV
SERLRALEEPYHYSRSAAQEISQQFPRLPNPDMVMYIFPHLVAGNTPIPGYSTVFPFYSQ
VQYALPGERTEAL
NT seq 402 nt NT seq  +upstreamnt  +downstreamnt
atgcggaaaataaaatattattggctgttggggttggcagggctattagtcggatgtacc
acttcgaaagacgccttactccctgccggaaagcagacagtactggcaatgtggcagggg
aataaggcaggtcatgccaccgaatcggcaagggaaacactgcgccgttctttaactgta
tctgaacggctcagggctctggaagaaccttatcattacagccgttcagccgcgcaggaa
atcagccagcagtttccccgcttacccaatcccgatatggtgatgtatatcttcccccat
ctggttgccggcaacacgccgataccgggctacagcacggtatttccgttttacagccaa
gtacagtatgccctgccgggtgaacgcacggaggcactgtaa

DBGET integrated database retrieval system