KEGG   Xanthomonas campestris pv. campestris 8004: XC_0275Help
Entry
XC_0275           gene      T00247                                 

Definition
(GenBank) XC0275
Organism
xcb  Xanthomonas campestris pv. campestris 8004
SSDB OrthologParalogGene clusterGFIT
Position
329062..329337
Genome map
NT seq 276 nt NT seq  +upstreamnt  +downstreamnt
ttggcgtcggcaatcggcggcgcgcttgccgcgccgaccggtcctgccgcaccggccgct
tccccgaaagtccaggccttcctggacgtcctcaactccgccggcggcaagccgatggag
caactcaccccgcagcaggcccgcaaggtgctggtggacgcgcaggccggcgcaaccctg
ccggccgccgaggtgacccgcaagacgatcaccgtcgatggcaagccgctcgggctggtg
gtggtcaagccgccgggcagtgccggcaagacgtag

DBGET integrated database retrieval system