KEGG   Xanthomonas campestris pv. campestris 8004: XC_0325Help
Entry
XC_0325           CDS       T00247                                 

Definition
(GenBank) conditioned medium factor
Organism
xcb  Xanthomonas campestris pv. campestris 8004
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAY47410
UniProt: A0A0H2X346
Position
complement(383761..385503)
Genome map
AA seq 580 aa AA seqDB search
MPVENGHLRFMVLAGDQQWDAAVAAPRVAGARAAAAPQLQAQRTRLGSADSGTSGMRYAV
DAAQNGVWSLTLQSASPTAQRGYVLMEGDPRTQLASYPRHRHQQVGQSLTLNALLSGSDA
QGAGLLAGQAGQIDQASLRVLDPQGTARTFAMADDGKHDDGAAGDGVYGGSFQPTSAGTW
IAQVIVHGRDQAGQPFVRTSEHVLPVLDTSVRLLGNALSARAADGTRLSIGLPIAARGQA
PTHYRVFGQVWGTDAKGKQIPVAWIGGMLTPQQGQLPLSLDERWVARAGARAPFTLRGLR
IEDPDHYIPLAQADTLPLQLQLPALRRASIARATAGIDESMRMGPRPRTLATASALAQPQ
AAGSRLVLVHGYCSNGVWPEAQFSNASSFIDAKQNRSNDQFAQRLAQFASQWSSFATVAH
SQGGMAALHLYTYYWSGLDNATGGRVMQSVGTPYQGTNLSGILAAVGSWFGVGCGSNTDL
TYDGAKAWLAGIPADARAKVNYYTTSFAKTNWYTNDYCNAASDLVLNDPEDGTVEQANAQ
LPGGVNRGHTTGQCHTTGMRDPAQYLDASRNAVMNANAAK
NT seq 1743 nt NT seq  +upstreamnt  +downstreamnt
ctgccggtggaaaacggccacctgcgtttcatggtgctggccggtgaccagcagtgggac
gcggccgtggccgcaccgcgcgttgccggcgcgcgcgccgcagcagcgccgcaactgcaa
gcacaacgcacacggctcggcagtgccgacagcggcaccagcggcatgcgctatgcagtg
gacgctgcgcagaacggtgtgtggtcgctgacgctgcagtcggcctcgcccacggcgcaa
cgtggctatgtgttgatggaaggcgacccgcgcacgcagctggcctcctatccacggcat
cgccaccagcaggtgggccagtcgctgacgctcaatgcgctgctcagcggcagcgatgca
caaggcgcgggcttattggctggccaggccgggcagatcgatcaggccagcctgcgcgtg
ctcgatccacagggcacggcgcgcacgtttgcgatggccgatgacggcaagcacgacgac
ggcgctgccggcgatggcgtgtatggcggcagctttcagccgaccagtgccggcacctgg
atcgcacaggtgatcgtgcatggccgcgaccaggccgggcagccgttcgtgcgtaccagc
gagcacgtattacccgtgctggacacctctgtgcgtctactcggcaacgcgctcagcgca
cgcgcggcggacggcacgcgcctgagtatcgggctgccgatcgccgcacgcgggcaggcg
cccacgcattaccgcgtgttcggtcaggtgtggggcaccgacgccaagggcaagcagatt
ccggtggcctggatcggcggcatgctcacaccgcagcaaggccagctgccgttgagcctg
gacgagcgctgggtggcgcgtgccggtgcgcgtgcaccgttcacgctgcgcggcctgcgc
atcgaagacccggaccattacatcccgttggcacaggccgacacgctgccgctgcagctg
cagctgcctgcactgcgccgggcgagtattgcgcgcgccacggccggcatcgatgaaagc
atgcgcatggggccgcgcccacgcacgctggccactgccagtgcactggcgcaaccgcag
gcggccggatcgcggctggtgctggtgcatgggtactgctccaacggcgtgtggccggaa
gcgcagttcagcaacgcctcgtcgtttatcgatgccaagcagaaccgcagcaacgatcaa
ttcgcacagcgtttggcgcagttcgccagccagtggtcctcgttcgccacggtggcgcac
agccagggcggcatggccgcgctgcatctgtacacctactactggagcgggctggataac
gccaccggtgggcgcgtgatgcagtcggtaggcacgccgtaccagggcaccaacctgtcc
ggcattctggctgcagtgggttcgtggttcggcgttgggtgcggcagcaacaccgacctc
acctacgacggcgccaaggcctggctggccggcattcccgccgatgcgcgcgccaaggtc
aactactacacgacctcgttcgccaagaccaactggtacaccaacgactactgcaacgcc
gcctcggacctggtcttgaacgaccccgaagacggcaccgtggagcaggccaatgcgcag
ctgccgggcggcgtaaaccggggccacaccaccgggcaatgccacaccaccggcatgcgc
gacccggcgcaatacctggacgccagccgcaacgcggtgatgaacgccaacgcggcgaag
tga

DBGET integrated database retrieval system