KEGG   Xanthomonas campestris pv. campestris 8004: XC_0349Help
Entry
XC_0349           CDS       T00247                                 

Definition
(GenBank) xanthomonadin biosynthesis related protein
Organism
xcb  Xanthomonas campestris pv. campestris 8004
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAY47434
UniProt: A0A0H2X2V5
Position
409050..409283
Genome map
AA seq 77 aa AA seqDB search
MVQPCSPGLPPGKSVPQLAGWSFPSDAAARDATEAKCTERSAGTTCQGEAPNLPQPATVM
TAVRSQPHAWPANSPKR
NT seq 234 nt NT seq  +upstreamnt  +downstreamnt
atggtgcaaccatgctccccaggactgccgcctgggaagagtgtgccacagcttgcggga
tggagctttcccagcgatgcagcggcgcgtgatgccaccgaagccaagtgcaccgagcgc
agcgcgggaacgacgtgccaaggcgaagcaccgaacttaccgcaaccagcaaccgtgatg
actgctgtccggagccaaccgcatgcatggcctgcgaactcaccgaagcggtaa

DBGET integrated database retrieval system