KEGG   Xanthomonas campestris pv. campestris 8004: XC_4356Help
Entry
XC_4356           tRNA      T00247                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
xcb  Xanthomonas campestris pv. campestris 8004
Pathway
xcb00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:xcb00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    XC_4356
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:xcb03100]
    XC_4356
Non-coding RNAs [BR:xcb03100]
 Transfer RNA
  tRNA
   XC_4356
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
2987981..2988055
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gctcccttcgtctagcggttaggacgtggccctctcaaggctaaaacaggggttcgagcc
ccctagggagcgcca

DBGET integrated database retrieval system