KEGG   Xenorhabdus nematophila ATCC 19061: XNC1_tRNA0025Help
Entry
XNC1_tRNA0025     tRNA      T01274                                 

Gene name
ArgACG
Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
xne  Xenorhabdus nematophila ATCC 19061
Pathway
xne00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:xne00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    XNC1_tRNA0025 (ArgACG)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:xne03100]
    XNC1_tRNA0025 (ArgACG)
Non-coding RNAs [BR:xne03100]
 Transfer RNA
  XNC1_tRNA0025 (ArgACG)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1131122..1131198
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gcatccatagctcagctggatagagtactcggctacgaaccgagcggtcggaggttcaaa
tcctcctggatgcacca

DBGET integrated database retrieval system