KEGG   Xenorhabdus nematophila ATCC 19061: XNC1_tRNA0051Help
Entry
XNC1_tRNA0051     tRNA      T01274                                 

Gene name
SerTGA
Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
xne  Xenorhabdus nematophila ATCC 19061
Pathway
xne00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:xne00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    XNC1_tRNA0051 (SerTGA)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:xne03100]
    XNC1_tRNA0051 (SerTGA)
Non-coding RNAs [BR:xne03100]
 Transfer RNA
  XNC1_tRNA0051 (SerTGA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2858822..2858909)
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
ggaaggatggccgagcggtcgaaggcagcggtcttgaaaaccgccgatgggaaaccatcc
tagagttcgaatctctatccttccgcca

DBGET integrated database retrieval system